Evaluation of the Strecker synthesis as a source of amino acids on carbonaceous chondrites

The Strecker synthesis (SS) has been proposed as the source of amino acids (AA) formed during aqueous alteration of carbonaceous chondrites. It is postulated that the aldehyde and ketone precursors of the meteoritic AA originated in interstellar syntheses and accreted on the meteorite parent body along with other reactant species in cometesimal ices. The SS has been run with formaldehyde, acetyldehyde, propionaldehyde, acetone, and methyl ketone as starting materials. To study the effect of minerals on the reaction, the SS was run in the presence and absence of dust from the Allende meteorite using deuterated aldehydes and ketones as starting materials. The products were studied by GC/MS. With the exception of glycine, the retention of deuterium in the AA was greater than 90 pct. Some D exchange with water does occur, however, and determination of the rate of exchange as a function of pH and temperature may allow some bounds to be placed on the duration of parent body aqueous alteration. The retention of D by the AA under conditions studied thus far is consistent with the model that a SS starting from interstellar aldehydes and ketones led to the production of meteoritic AA

The Kelvin Formula for Thermopower

Thermoelectrics are important in physics, engineering, and material science due to their useful applications and inherent theoretical difficulty, especially in strongly correlated materials. Here we reexamine the framework for calculating the thermopower, inspired by ideas of Lord Kelvin from 1854. We find an approximate but concise expression, which we term as the Kelvin formula for the the Seebeck coefficient. According to this formula, the Seebeck coefficient is given as the particle number $N$ derivative of the entropy $\Sigma$, at constant volume $V$ and temperature $T$, $S_{\text{Kelvin}}=\frac{1}{q_e}\{\frac{\partial {\Sigma}}{\partial N} \}_{V,T}$. This formula is shown to be competitive compared to other approximations in various contexts including strongly correlated systems. We finally connect to a recent thermopower calculation for non-Abelian fractional quantum Hall states, where we point out that the Kelvin formula is exact.Comment: 6 pages, 2 figure

Avatars:the other side of Proteus's mirror : a study into avatar choice regarding perception

The trend for online interactions, can be regarded as being ‘anti-so-cially social’, meaning that a great deal of time is spent playing, working and socializing with the internet serving as the communication conduit. Within that Virtual Social Environment very deep relationships are formed and maintained without the parties ever having met each other face-to-face. Raising the question how much does the physical appearance of an avatar influence the perception of the person behind it? Are relationships informed by appearance even in the vir-tual world and what implications does that have for second language acquisition? This paper leads to a small-scale research project where a selection of avatars with various racially identifiable characteristics were used to identify which av-atars a second language speaker would feel more at ease interacting with in the target language. The resultant research aims to test three hypotheses regarding preferred avatar choice for second language users based solely on perceptions

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Strong Optomechanical Squeezing of Light

We create squeezed light by exploiting the quantum nature of the mechanical interaction between laser light and a membrane mechanical resonator embedded in an optical cavity. The radiation pressure shot noise (fluctuating optical force from quantum laser amplitude noise) induces resonator motion well above that of thermally driven motion. This motion imprints a phase shift on the laser light, hence correlating the amplitude and phase noise, a consequence of which is optical squeezing. We experimentally demonstrate strong and continuous optomechanical squeezing of 1.7 +/- 0.2 dB below the shot noise level. The peak level of squeezing measured near the mechanical resonance is well described by a model whose parameters are independently calibrated and that includes thermal motion of the membrane with no other classical noise sources.Comment: 12 pages, 8 figure

Orbital Landau level dependence of the fractional quantum Hall effect in quasi-two dimensional electron layers: finite-thickness effects

The fractional quantum Hall effect (FQHE) in the second orbital Landau level at filling factor 5/2 remains enigmatic and motivates our work. We consider the effect of the quasi-2D nature of the experimental FQH system on a number of FQH states (fillings 1/3, 1/5, 1/2) in the lowest, second, and third Landau levels (LLL, SLL, TLL,) by calculating the overlap, as a function of quasi-2D layer thickness, between the exact ground state of a model Hamiltonian and the consensus variational wavefunctions (Laughlin wavefunction for 1/3 and 1/5 and the Moore-Read Pfaffian wavefunction for 1/2). Using large overlap as a stability, or FQHE robustness, criterion we find the FQHE does not occur in the TLL (for any thickness), is the most robust for zero thickness in the LLL for 1/3 and 1/5 and for 11/5 in the SLL, and is most robust at finite-thickness (4-5 magnetic lengths) in the SLL for the mysterious 5/2 state and the 7/3 state. No FQHE is found at 1/2 in the LLL for any thickness. We examine the orbital effects of an in-plane (parallel) magnetic field finding its application effectively reduces the thickness and could destroy the FQHE at 5/2 and 7/3, while enhancing it at 11/5 as well as for LLL FQHE states. The in-plane field effects could thus be qualitatively different in the LLL and the SLL by virtue of magneto-orbital coupling through the finite thickness effect. In the torus geometry, we show the appearance of the threefold topological degeneracy expected for the Pfaffian state which is enhanced by thickness corroborating our findings from overlap calculations. Our results have ramifications for wavefunction engineering--the possibility of creating an optimal experimental system where the 5/2 FQHE state is more likely described by the Pfaffian state with applications to topological quantum computing.Comment: 27 pages, 20 figures, revised version (with additional author) as accepted for publication in Physical Review

Improving broadband displacement detection with quantum correlations

Interferometers enable ultrasensitive measurement in a wide array of applications from gravitational wave searches to force microscopes. The role of quantum mechanics in the metrological limits of interferometers has a rich history, and a large number of techniques to surpass conventional limits have been proposed. In a typical measurement configuration, the tradeoff between the probe's shot noise (imprecision) and its quantum backaction results in what is known as the standard quantum limit (SQL). In this work we investigate how quantum correlations accessed by modifying the readout of the interferometer can access physics beyond the SQL and improve displacement sensitivity. Specifically, we use an optical cavity to probe the motion of a silicon nitride membrane off mechanical resonance, as one would do in a broadband displacement or force measurement, and observe sensitivity better than the SQL dictates for our quantum efficiency. Our measurement illustrates the core idea behind a technique known as \textit{variational readout}, in which the optical readout quadrature is changed as a function of frequency to improve broadband displacement detection. And more generally our result is a salient example of how correlations can aid sensing in the presence of backaction.Comment: 17 pages, 5 figure